| Primer map for the 16S SSU rRNA gene. This map includes both universal and specific primers (please see below for the target group of each). |
| Primer* | Sequence (5’-3’) | Target Group | Reference |
| 8F | AGAGTTTGATCCTGGCTCAG | Universal | Turner et al. 1999 |
| 27F | AGAGTTTGATCMTGGCTCAG | Universal | Lane et al. 1991 |
| CYA106F | CGGACGGGTGAGTAACGCGTGA | Cyanobacteria | Nübel et al. 1997 |
| CC [F] | CCAGACTCCTACGGGAGGCAGC | Universal | Rudi et al. 1997 |
| 357F | CTCCTACGGGAGGCAGCAG | Universal | Turner et al. 1999 |
| CYA359F | GGGGAATYTTCCGCAATGGG | Cyanobacteria | Nübel et al. 1997 |
| 515F | GTGCCAGCMGCCGCGGTAA | Universal | Turner et al. 1999 |
| 533F | GTGCCAGCAGCCGCGGTAA | Universal | Weisburg et al. 1991 |
| 895F | CRCCTGGGGAGTRCRG | Bacteria exc. plastids & Cyanobacteria | Hodkinson & Lutzoni 2009 |
| 16S.1100.F16 | CAACGAGCGCAACCCT | Universal | Turner et al. 1999 |
| 1237F | GGGCTACACACGYGCWAC | Universal | Turner et al. 1999 |
| 519R | GWATTACCGCGGCKGCTG | Universal | Turner et al. 1999 |
| CYA781R | GACTACWGGGGTATCTAATCCCWTT | Cyanobacteria | Nübel et al. 1997 |
| CD [R] | CTTGTGCGGGCCCCCGTCAATTC | Universal | Rudi et al. 1997 |
| 902R | GTCAATTCITTTGAGTTTYARYC | Bacteria exc. plastids & Cyanobacteria | Hodkinson & Lutzoni 2009 |
| 904R | CCCCGTCAATTCITTTGAGTTTYAR | Bacteria exc. plastids & Cyanobacteria | Hodkinson & Lutzoni 2009 |
| 907R | CCGTCAATTCMTTTRAGTTT | Universal | Lane et al. 1991 |
| 1100R | AGGGTTGCGCTCGTTG | Bacteria | Turner et al. 1999 |
| 1185mR | GAYTTGACGTCATCCM | Bacteria exc. plastids & Cyanobacteria | Hodkinson & Lutzoni 2009 |
| 1185aR | GAYTTGACGTCATCCA | Lichen-associated Rhizobiales | Hodkinson & Lutzoni 2009 |
| 1381R | CGGTGTGTACAAGRCCYGRGA | Bacteria exc. Asterochloris sp. plastids | Hodkinson & Lutzoni 2009 |
| 1381bR | CGGGCGGTGTGTACAAGRCCYGRGA | Bacteria exc. Asterochloris sp. plastids | Hodkinson & Lutzoni 2009 |
| 1391R | GACGGGCGGTGTGTRCA | Universal | Turner et al. 1999 |
| 1492R (l) | GGTTACCTTGTTACGACTT | Universal | Turner et al. 1999 |
| 1492R (s) | ACCTTGTTACGACTT | Universal | Lane et al. 1991 |
*Numbered primers are named for the approximate position on the E. coli 16S rRNA molecule. For each degenerate primer, an equimolar mix of all of the constituent primers implied by the degenerate sequence is recommended, since machine mixes are generally not guaranteed to approximate equimolarity. Primers developed by members of the Lutzoni Lab are in bold.
Non-Photobiont Primers
Hodkinson and Lutzoni (2009) have designed a set of 16S rDNA PCR primers for exploring bacterial diversity (that is, non-cyanobacterial, non-plastid diversity) in samples with abundant cyanobacterial and/or plastid-derived DNA (e.g., lichens, plants, macro-algae, cyanobacterial mats, etc.). Each of these specifically-designed primers can be paired with a universal 16S primer in order to amplify non-photobiont 16S sequences (universal primers 27F, 533F, and 1492R have been used successfully for this purpose). Primer design involved identifying the relatively conserved sites across the eubacteria and targeting sites shared only by plastids and Cyanobacteria for exclusion, leading to the development of four primers (895F, 902R, 904R, and 1185mR) to accommodate the remaining eubacterial diversity. Two primers (1381R and 1381bR) were designed to target a wider array of 16S sequences, and are intended to exclude only sequences derived from Asterochloris sp., the primary algal partner for members of Cladoniaceae, Stereocaulaceae, and several other groups of lichenized fungi. Additionally, a primer has been designed to amplify sequences from lichen-associated Rhizobiales bacteria (1185aR), including both the newly-defined LAR1 (Lichen-Associated Rhizobiales 1) lineage and members of the genus Methylobacterium.
Cyanobacterial Primers
Although universal 16S primers can be used to amplify cyanobacterial sequences, the diversity of bacteria present in cyanolichens and other environmental samples often necessitates the use of cyanobacteria-specific primers. The primers used in our lab for the amplification of cyanobacterial 16S can be found in publications by Nübel et al. (1997), Rudi et al. (1997), and Turner et al. (1999). Publications by Rudi et al. (1998) and O’Brien et al. (2005) provide additional information and applications.
References
Hodkinson, B.P., and Lutzoni, F. 2009. A microbiotic survey of lichen-associated bacteria reveals a new lineage from the Rhizobiales. Symbiosis 49: 163-180.
Download publication (PDF file)
Lane, D.J. 1991. 16S/23S rRNA sequencing. In: Nucleic acid techniques in bacterial systematics. Stackebrandt, E., and Goodfellow, M., eds., John Wiley and Sons, New York, NY, pp. 115-175.
Nübel, U., Garcia-Pichel, F., and Muyzer, G. 1997. PCR primers to amplify 16S rRNA genes from cyanobacteria. Applied and Environmental Microbiology 63: 3327–3332.
O’Brien, H., Miadlikowska, J., and Lutzoni, F. 2005. Assessing host specialization in symbiotic Cyanobacteria associated with four closely related species of the lichen fungus Peltigera. European Journal of Phycology 40:363-378.
Download publication (PDF file)
Rudi, K., Skulberg, O.M., Larsen, F., and Jakobsen, K.S. 1997. Strain characterization and classification of oxyphotobacteria in clone cultures on the basis of 16S rRNA sequences from the variable regions V6, V7 and V8. Applied and Environmental Microbiology 63:2593-2599.
Rudi, K., Skulberg, O.M., and Jakobsen, K.S. 1998. Evolution of cyanobacteria by exchange of genetic material among phyletically related strains. Journal of Bacteriology 180: 3453–3461.
Turner, S., Pryer, K.M., Miao, V.P.W., and Palmer, J.D. 1999. Investigating deep phylogenetic relationships among cyanobacteria and plastids by small subunit rRNA sequence analysis. Journal of Eukaryotic Microbiology 46: 327–338.
Weisburg, W.G., Barns, S.M., Pelletier, D.A., and Lane, D.J. 1991. 16S ribosomal DNA amplification for phylogenetic study. Journal of Bacteriology 173: 697-703.